ID: 1032083281_1032083292

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1032083281 1032083292
Species Human (GRCh38) Human (GRCh38)
Location 7:128870462-128870484 7:128870515-128870537
Sequence CCCCAGGAGGCCTCGGCTCTCTT AGGGTCCTCCTCTCAGACTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 164} {0: 1, 1: 0, 2: 0, 3: 17, 4: 269}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!