ID: 1032106333_1032106337

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1032106333 1032106337
Species Human (GRCh38) Human (GRCh38)
Location 7:129034375-129034397 7:129034391-129034413
Sequence CCCAGCTACTGGGGGGTGTGGGC TGTGGGCAGGAACACTGAGGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 69, 4: 1337} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!