ID: 1032117047_1032117063

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1032117047 1032117063
Species Human (GRCh38) Human (GRCh38)
Location 7:129126457-129126479 7:129126502-129126524
Sequence CCGGCCCGCCCACTACGGGCCCA GGCCCGCGGAGCCCGGATGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 1, 3: 21, 4: 144}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!