ID: 1032252728_1032252737

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1032252728 1032252737
Species Human (GRCh38) Human (GRCh38)
Location 7:130271895-130271917 7:130271938-130271960
Sequence CCTTCCTGCATCTGCTACTCCAT CAGTGCTGCATTTACTTCTGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 18, 4: 312}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!