ID: 1032356463_1032356465

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1032356463 1032356465
Species Human (GRCh38) Human (GRCh38)
Location 7:131215702-131215724 7:131215737-131215759
Sequence CCAAACAAGGAGAGTTTGTCTTT CTGTGATGATGGAGATACCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 246} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!