ID: 1032463221_1032463232

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1032463221 1032463232
Species Human (GRCh38) Human (GRCh38)
Location 7:132126957-132126979 7:132127000-132127022
Sequence CCAAGAAATGTCAGGGTCTCTCC TGGGTAAAAGCTGCATCTGGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 21, 4: 205} {0: 1, 1: 0, 2: 0, 3: 17, 4: 148}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!