ID: 1032465983_1032465992

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1032465983 1032465992
Species Human (GRCh38) Human (GRCh38)
Location 7:132145357-132145379 7:132145394-132145416
Sequence CCTCACAGACCTAGGCAGGGGAG CACCCTACTTGGGTAAAATTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 14, 4: 213} {0: 1, 1: 0, 2: 0, 3: 4, 4: 93}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!