ID: 1032472191_1032472197

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1032472191 1032472197
Species Human (GRCh38) Human (GRCh38)
Location 7:132186518-132186540 7:132186544-132186566
Sequence CCAGACTGAGCCCAAATCCTCTC AAGAGCACGTCCACTTTGTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 163} {0: 1, 1: 0, 2: 0, 3: 3, 4: 64}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!