ID: 1032480662_1032480669

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1032480662 1032480669
Species Human (GRCh38) Human (GRCh38)
Location 7:132244153-132244175 7:132244197-132244219
Sequence CCCAGTTTCCTGGGTAAACTTGG TTGTGATGATCTGAAAAATGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 136} {0: 1, 1: 0, 2: 4, 3: 37, 4: 416}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!