ID: 1032486580_1032486593

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1032486580 1032486593
Species Human (GRCh38) Human (GRCh38)
Location 7:132292213-132292235 7:132292265-132292287
Sequence CCCTGACTGTCAAATGCCTCTTT CAGGTAAATCAGAGGGAGGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 41, 4: 270}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!