ID: 1032777262_1032777268

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1032777262 1032777268
Species Human (GRCh38) Human (GRCh38)
Location 7:135126776-135126798 7:135126813-135126835
Sequence CCCTGTTCAATAAGTGATGCTGG CATGTGCAGAAAACTGAAACTGG
Strand - +
Off-target summary No data {0: 59, 1: 2328, 2: 3416, 3: 15026, 4: 6727}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!