ID: 1032777262_1032777268 |
View in Genome Browser |
Spacer: 14 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1032777262 | 1032777268 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 7:135126776-135126798 | 7:135126813-135126835 |
Sequence | CCCTGTTCAATAAGTGATGCTGG | CATGTGCAGAAAACTGAAACTGG |
Strand | - | + |
Off-target summary | No data | {0: 59, 1: 2328, 2: 3416, 3: 15026, 4: 6727} |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |