ID: 1032779361_1032779365

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1032779361 1032779365
Species Human (GRCh38) Human (GRCh38)
Location 7:135151274-135151296 7:135151299-135151321
Sequence CCCTGTTTTGAAAAGAATTAGAA TGGACTCATGTTTCTACCAAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 15, 4: 120}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!