ID: 1033146121_1033146130

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1033146121 1033146130
Species Human (GRCh38) Human (GRCh38)
Location 7:138871264-138871286 7:138871295-138871317
Sequence CCCGCCGGCTAGCCTCCGGGGGG CCTGTCCACGTGCTCGAAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 69} {0: 1, 1: 0, 2: 0, 3: 7, 4: 47}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!