ID: 1033148973_1033148982

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1033148973 1033148982
Species Human (GRCh38) Human (GRCh38)
Location 7:138896745-138896767 7:138896794-138896816
Sequence CCCACCATGCCCAGCTAGCTTAT TCTTGCTATGTTTCCCAGGCTGG
Strand - +
Off-target summary No data {0: 276, 1: 6988, 2: 44516, 3: 140480, 4: 241443}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!