ID: 1033231243_1033231244

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1033231243 1033231244
Species Human (GRCh38) Human (GRCh38)
Location 7:139599853-139599875 7:139599872-139599894
Sequence CCTAGGTCTAACTGTGCACTCTG TCTGCTGTACAATCTACTTTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 12, 4: 179}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!