ID: 1033277397_1033277405

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1033277397 1033277405
Species Human (GRCh38) Human (GRCh38)
Location 7:139982727-139982749 7:139982752-139982774
Sequence CCCCTAAAGGATCACAGCCCACA TTGAAAAACACTGGGTTAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 152} {0: 1, 1: 0, 2: 5, 3: 72, 4: 406}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!