ID: 1033282854_1033282860

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1033282854 1033282860
Species Human (GRCh38) Human (GRCh38)
Location 7:140018019-140018041 7:140018059-140018081
Sequence CCTCTACCTCTCAACATCCTGTG CACAGCGCTCAGGTAAGCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 472} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!