ID: 1033331463_1033331467

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1033331463 1033331467
Species Human (GRCh38) Human (GRCh38)
Location 7:140420414-140420436 7:140420447-140420469
Sequence CCATATCAAAAAAAAAAAAAAAA AAGAAGGAGCAGAAGGAGGCAGG
Strand - +
Off-target summary {0: 702, 1: 87403, 2: 67138, 3: 121105, 4: 152393} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!