ID: 1033348667_1033348671

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1033348667 1033348671
Species Human (GRCh38) Human (GRCh38)
Location 7:140544544-140544566 7:140544592-140544614
Sequence CCTGCTCTACAGACTAGAGGGTC TTAGCAGAAGTAGCCAAGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 64} {0: 1, 1: 0, 2: 0, 3: 7, 4: 167}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!