ID: 1033366813_1033366819

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1033366813 1033366819
Species Human (GRCh38) Human (GRCh38)
Location 7:140678340-140678362 7:140678360-140678382
Sequence CCCACCGGGCCACATCCAGGTGT TGTCATTGGATATATCACTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 81} {0: 1, 1: 0, 2: 6, 3: 137, 4: 1375}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!