ID: 1033658043_1033658047

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1033658043 1033658047
Species Human (GRCh38) Human (GRCh38)
Location 7:143386531-143386553 7:143386552-143386574
Sequence CCACTGCTTTCTGCAGCTTGGAA AAGCAGAAACAGGAAGAGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 41, 4: 348} {0: 1, 1: 3, 2: 10, 3: 106, 4: 1139}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!