ID: 1033737515_1033737520

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1033737515 1033737520
Species Human (GRCh38) Human (GRCh38)
Location 7:144237901-144237923 7:144237944-144237966
Sequence CCTCTCCAAACTCGTTTCCTCTT ATAGTACCTATTTTATGAGGTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 6, 3: 42, 4: 352} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!