ID: 1033946959_1033946960

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1033946959 1033946960
Species Human (GRCh38) Human (GRCh38)
Location 7:146730864-146730886 7:146730911-146730933
Sequence CCACATTGATGAATAATAATCAA ACATCAGCTTCCATTTTCAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 22, 4: 311} {0: 1, 1: 0, 2: 1, 3: 27, 4: 267}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!