ID: 1033951986_1033951992 |
View in Genome Browser |
Spacer: -2 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1033951986 | 1033951992 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 7:146796347-146796369 | 7:146796368-146796390 |
| Sequence | CCTGAGGAGTTCTGGGCTGGAGT | GTTTTTAAGGGGATTGTGGAGGG |
| Strand | - | + |
| Off-target summary | No data | {0: 6, 1: 27, 2: 45, 3: 72, 4: 290} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||