ID: 1034003002_1034003004

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1034003002 1034003004
Species Human (GRCh38) Human (GRCh38)
Location 7:147437153-147437175 7:147437193-147437215
Sequence CCAACACCAGAGGGATTGCTGAT TTCCTACATTTATGATAATGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 87} {0: 1, 1: 0, 2: 0, 3: 21, 4: 245}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!