ID: 1034052879_1034052884

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1034052879 1034052884
Species Human (GRCh38) Human (GRCh38)
Location 7:148001289-148001311 7:148001312-148001334
Sequence CCTGGGTCCTAGCCTTCAGCCTG GCTCTCAGCACAGCTCTTTGCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 19, 4: 219}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!