ID: 1034136226_1034136230

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1034136226 1034136230
Species Human (GRCh38) Human (GRCh38)
Location 7:148772825-148772847 7:148772866-148772888
Sequence CCTGCAGGGTCTGGACGTAGCCT AGTAAGCAGCCTGCCTGTCTCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 18, 4: 212}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!