ID: 1034189966_1034189978

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1034189966 1034189978
Species Human (GRCh38) Human (GRCh38)
Location 7:149206529-149206551 7:149206578-149206600
Sequence CCGGGACAGAGAGGACTGACTCC AGCCACGGAGAGCAAAGGCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 196} {0: 1, 1: 0, 2: 4, 3: 26, 4: 257}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!