ID: 1034267218_1034267228

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1034267218 1034267228
Species Human (GRCh38) Human (GRCh38)
Location 7:149787051-149787073 7:149787087-149787109
Sequence CCAGCCTGCCGCCACCGAGGCTG TCACAGTCCATCCTGGAGTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 277} {0: 1, 1: 0, 2: 2, 3: 10, 4: 202}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!