ID: 1034330066_1034330069

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1034330066 1034330069
Species Human (GRCh38) Human (GRCh38)
Location 7:150274851-150274873 7:150274888-150274910
Sequence CCTTATCACTTTTGATACAGTGT TCTCCTGGATGACGTTCTGGCGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 2, 3: 12, 4: 165}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!