ID: 1034398978_1034398989 |
View in Genome Browser |
Spacer: 25 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1034398978 | 1034398989 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 7:150848881-150848903 | 7:150848929-150848951 |
Sequence | CCTGTGTGTGGTCCTCTGTGACA | GGATAGAGTCCCAGGACTTGGGG |
Strand | - | + |
Off-target summary | {0: 1, 1: 2, 2: 5, 3: 71, 4: 565} | No data |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |