ID: 1034398978_1034398989

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1034398978 1034398989
Species Human (GRCh38) Human (GRCh38)
Location 7:150848881-150848903 7:150848929-150848951
Sequence CCTGTGTGTGGTCCTCTGTGACA GGATAGAGTCCCAGGACTTGGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 5, 3: 71, 4: 565} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!