ID: 1034436027_1034436030

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1034436027 1034436030
Species Human (GRCh38) Human (GRCh38)
Location 7:151063143-151063165 7:151063158-151063180
Sequence CCGGCTGTGCCGGCCGGCCGCTG GGCCGCTGCTCCGCGCCCGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 50, 4: 468} {0: 1, 1: 0, 2: 2, 3: 21, 4: 323}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!