ID: 1034439661_1034439677

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1034439661 1034439677
Species Human (GRCh38) Human (GRCh38)
Location 7:151080333-151080355 7:151080366-151080388
Sequence CCGACCACCTCCCTCTCCCACAG CGGCACAGAGGGTGGAACGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 327, 4: 6045} {0: 1, 1: 0, 2: 0, 3: 7, 4: 128}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!