ID: 1034463436_1034463440

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1034463436 1034463440
Species Human (GRCh38) Human (GRCh38)
Location 7:151211208-151211230 7:151211240-151211262
Sequence CCTATGGGGGAACAAATACTTCA ATGCTGTGATTAAAGAAACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 120} {0: 1, 1: 0, 2: 2, 3: 21, 4: 230}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!