ID: 1034468944_1034468967

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1034468944 1034468967
Species Human (GRCh38) Human (GRCh38)
Location 7:151245629-151245651 7:151245681-151245703
Sequence CCCCCTGGTGGGGCATCCGGGCT GGCGGGGGTGAAGCAGAAACGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 132} {0: 1, 1: 0, 2: 1, 3: 20, 4: 226}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!