ID: 1034473209_1034473216

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1034473209 1034473216
Species Human (GRCh38) Human (GRCh38)
Location 7:151267410-151267432 7:151267459-151267481
Sequence CCGTGTTCTTTCTGAGTCACTAT ATGTACTGCGAAGTCCTCAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 311} {0: 1, 1: 0, 2: 0, 3: 2, 4: 77}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!