ID: 1034498125_1034498140

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1034498125 1034498140
Species Human (GRCh38) Human (GRCh38)
Location 7:151433936-151433958 7:151433980-151434002
Sequence CCGAGAGCCCACCAGGACACGGG TGGGCTGATGTGGGACCCAGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 25, 4: 294}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!