ID: 1034527593_1034527599

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1034527593 1034527599
Species Human (GRCh38) Human (GRCh38)
Location 7:151675572-151675594 7:151675595-151675617
Sequence CCAGGGGAAACGTGTGCTGCTTG GTCACTTGGGTGGGTGTTGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 102} {0: 1, 1: 0, 2: 1, 3: 8, 4: 191}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!