ID: 1034533230_1034533235

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1034533230 1034533235
Species Human (GRCh38) Human (GRCh38)
Location 7:151710405-151710427 7:151710426-151710448
Sequence CCCTTTGCTCCGCTGCCACACTG TGAGGCCACATGAACCTTCGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 185} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!