ID: 1034612569_1034612575

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1034612569 1034612575
Species Human (GRCh38) Human (GRCh38)
Location 7:152385182-152385204 7:152385232-152385254
Sequence CCTGACTACAGGAACTCTACAGG AATTGTGAGAATAAAAAGGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 2, 3: 68, 4: 658}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!