ID: 1034636304_1034636306

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1034636304 1034636306
Species Human (GRCh38) Human (GRCh38)
Location 7:152569940-152569962 7:152569953-152569975
Sequence CCATGGGTTTGCCAGCTCTTCTG AGCTCTTCTGTTTTTTTCTCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 54, 4: 578}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!