ID: 1034825134_1034825141

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1034825134 1034825141
Species Human (GRCh38) Human (GRCh38)
Location 7:154255451-154255473 7:154255480-154255502
Sequence CCACTCCCAGCACTGGGGGAAAG GCTCTTTGAATTCTGCGGTGCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 12, 4: 120}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!