ID: 1034842145_1034842154 |
View in Genome Browser |
Spacer: -5 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1034842145 | 1034842154 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 7:154408833-154408855 | 7:154408851-154408873 |
Sequence | CCCCCCAACTCAAATTTATATGT | TATGTTAAGGCCGGGCCTGGTGG |
Strand | - | + |
Off-target summary | {0: 1, 1: 1, 2: 9, 3: 56, 4: 383} | No data |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |