ID: 1034845441_1034845445

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1034845441 1034845445
Species Human (GRCh38) Human (GRCh38)
Location 7:154440257-154440279 7:154440271-154440293
Sequence CCCACGCCTGCAGTCTCTGCAGT CTCTGCAGTTATTCACATGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 373} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!