ID: 1034885135_1034885141

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1034885135 1034885141
Species Human (GRCh38) Human (GRCh38)
Location 7:154793521-154793543 7:154793549-154793571
Sequence CCAATTTCCCTAATTAGCTAGAG CCCTGGGTATTTTATCTTTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 143} {0: 1, 1: 0, 2: 1, 3: 26, 4: 209}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!