ID: 1034885277_1034885286

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1034885277 1034885286
Species Human (GRCh38) Human (GRCh38)
Location 7:154794183-154794205 7:154794205-154794227
Sequence CCACGGGGGTCTGCACGAAGGTA ACGCGGGGCTGTGGGGGTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 34} {0: 1, 1: 0, 2: 7, 3: 79, 4: 866}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!