ID: 1034885370_1034885378

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1034885370 1034885378
Species Human (GRCh38) Human (GRCh38)
Location 7:154794581-154794603 7:154794610-154794632
Sequence CCGACAGCCTCCCCCAGCGGGCT GTGCGTCCCTCCCCACGTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 248} {0: 1, 1: 0, 2: 3, 3: 29, 4: 119}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!