ID: 1035010404_1035010407

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1035010404 1035010407
Species Human (GRCh38) Human (GRCh38)
Location 7:155710795-155710817 7:155710809-155710831
Sequence CCAGAGTTCCTGGAGGGGGATGC GGGGGATGCAAGGCTGCTACAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 15, 4: 200} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!