ID: 1035018633_1035018645

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1035018633 1035018645
Species Human (GRCh38) Human (GRCh38)
Location 7:155787635-155787657 7:155787661-155787683
Sequence CCCTGGTGGGAGCGAGCACCGGG GGTGAGGGGTGCGCCGCGGGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!