ID: 1035140521_1035140526

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1035140521 1035140526
Species Human (GRCh38) Human (GRCh38)
Location 7:156755263-156755285 7:156755299-156755321
Sequence CCAAAGGATTTATAAAGATTCTA TACTTTTCCTACTGTGGAAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 458} {0: 1, 1: 0, 2: 2, 3: 15, 4: 257}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!